aav vectors expressing shrna targeting chrebp Search Results


90
VectorBuilder GmbH aav vectors expressing shrna targeting chrebp
a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated <t>viruses</t> <t>(AAV)</t> -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.
Aav Vectors Expressing Shrna Targeting Chrebp, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav vectors expressing shrna targeting chrebp/product/VectorBuilder GmbH
Average 90 stars, based on 1 article reviews
aav vectors expressing shrna targeting chrebp - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

Journal: Nature Communications

Article Title: Sex difference in BAT thermogenesis depends on PGC-1α–mediated phospholipid synthesis in mice

doi: 10.1038/s41467-025-61219-w

Figure Lengend Snippet: a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

Article Snippet: AAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT) and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively.

Techniques: Gene Expression, Injection, Labeling